Перейти на главную страницу
Поиск по сайту

Noxa 20 инструкция

Huron, McGaw Pavilion M300, Chicago, Noxa 20 инструкция 60611, USA. E-mail: Elevated ambient levels of particulate matter air pollution are associated with excess daily mortality, largely attributable to increased rates of cardiovascular events. We have previously reported that particulate matter induces p53-dependent apoptosis in primary human alveolar epithelial cells. Activation of the intrinsic apoptotic pathway by p53 often requires the transcription of the proapoptotic Bcl-2 proteins Noxa, Puma, or both. Exposure to PM 2. Twenty-four hours after the intratracheal instillation of PM 2. These changes were associated with increased permeability of the alveolar-capillary membrane and inflammation. We conclude that PM 2. Proapoptotic Noxa is required for particulate matter-induced cell death and lung inflammation. Exposures to higher levels of PM 2. Longer-term exposure to PM 2. Ambient urban particulate matter is composed of a core of ash or carbon, the surface of which is coated with organic molecules and transition metals. Inhaled particles are thought to gain access to cells within the lung and perhaps other tissues, where they interact with membrane-bound or intracellular proteins to generate superoxide anion and other reactive oxygen species ROSwhich are required for the biological response to the particles. The induction of apoptosis through the intrinsic pathway requires activation of the proapoptotic Bcl-2 proteins Bax or Bak, which is, in turn, regulated by one or more of a group of proapoptotic Bcl-2 proteins that contain only a single BH domain BH3 domain-only proteins. Apoptosis induced by p53 has been shown to be regulated by the BH3 domain-only proteins Noxa and Puma. Consistent with these observations, we found that PM 2. The characteristics of the PM 2. Titanium dioxide TiO 2 was purchased from Sigma-Aldrich St. Antibodies and reagents The following antibodies were used: cleaved noxa 20 инструкция Asp175 catalog 9661; Cell Signaling, Boston, Noxa 20 инструкция, USAMcl-1 catalog 4572; Cell Signaling. Cell culture reagents were obtained from Life Technologies, Inc. Animals and intratracheal administration of particulate matter The protocol for the use of mice was approved noxa 20 инструкция the Animal Care and Use Committee at Northwestern University. Andreas Strasser The Walter and Eliza Hall Institute of Medical Research, Melbourne, Australia. We instilled either PM 2. The particulate matter and TiO 2 stocks were vortexed prior to instillation. After noxa 20 инструкция aliquot the mice were placed in the right and then the left lateral decubitus position for 10—15 s. Histology A 20-gauge angiocath was sutured into the trachea, noxa 20 инструкция lungs and heart were removed en bloc, and the lungs were inflated to 15 cm of H 2O with 4% paraformaldehyde. The heart and lungs were fixed in paraffin, and 5-μm sections were stained with hematoxylin and eosin. Bronchoalveolar lavage BAL analysis A BAL was performed through a 20-gauge angiocath ligated into the trachea. A 200-μl aliquot of the BAL fluid was placed in a cytospin and centrifuged at 500 g for 5 min. The glass slides were Wright noxa 20 инструкция and subjected to a masked manual cell count and differential. The remaining BAL fluid was centrifuged at 200 g for 5 min, and the supernatant was used for the measurement of BAL protein Bradford and cytokine analysis. The cells were purified by negative immunoselection by using magnetic beads, followed by differential adherence to CD90 pretreated dishes. Cells were cultured at an noxa 20 инструкция interface on 0. Alveolar type II cells were also isolated from rats, as described previously and used 2 d after isolation. A549 cells were obtained from American Type Culture Collection. Cells were exposed to noxa 20 инструкция in an Invivo2 400 CMV400 hypoxia workstation Biotrace International, St. Paul, MN, USA maintained at 0% O 2, as described previously. Assessment of lung permeability was performed using noxa 20 инструкция modification of a previously described technique. Twenty-four hours after treatment with either PM 2. The mice were kept sedated for 30 min, after which a noxa 20 инструкция angiocath was sutured into the noxa 20 инструкция for the collection of BAL fluid. Immediately following the BAL, 400 μl of blood was collected from the right ventricle into noxa 20 инструкция syringe containing 50 μl of sodium citrate 3. Relative lung permeability was estimated noxa 20 инструкция the difference in the fluorescence of the plasma, and the BAL fluid was measured by using a microplate reader excitation, noxa 20 инструкция nm; emission, 530 nm. BAL fluid protein levels were measured on freshly obtained unspun samples using a DC protein assay Bio-Rad Laboratories, Hercules, CA, USA. Briefly, cells were washed twice with PBS and detached with Trypsin-EDTA Mediatech, Inc. Twenty-five microliters of that solution was placed on 75- × 25-mm glass slides VWR, West Chester, PA, USA and air-dried for 25 min at room temperature. Cells were then fixed 1 h noxa 20 инструкция freshly prepared paraformaldehyde 4% in PBS, pH 7. Slides were washed twice with 0. Approximately 10 high-power fields ×400 were randomly selected per slide and photographed using an Eclipse TE-2000 microscope Nikon, Melville, NY, USA. Positive nuclei and DAPI-positive nuclei were counted using ImageJ software National Institutes of Health, Bethesda, MD, USA. Annexin V staining Cells were dispersed by trypsin:EDTA Mediatech, Inc. Annexin V staining was then determined using the ApoAlert Annexin V kit Clontech, Palo Alto, CA, USAas described by the manufacturer. Briefly, the cells were washed noxa 20 инструкция 1× binding buffer by centrifugation and then resuspended in 200 μl noxa 20 инструкция 1× binding buffer noxa 20 инструкция Annexin V 0. After incubation at room temperature for 15 min, the cells were analyzed by flow cytometry using a DakoCytomation CyAn high-speed multilaser droplet cell sorter excitation, 488 nm; emission, 535 nm; DakoCytomation, Glostrup, Denmark. Real-time reverse transcriptase PCR measurement of RNA Wild-type mice were treated with PM 2. QRT-PCR reactions were performed using IQ SYBR Green-superscript Bio-Rad Laboratories with the primers listed below and analyzed on an IQ5 Real-Time PCR Detection System. Cycle noxa 20 инструкция C t values were normalized to C t values for ribosomal protein 18s, and data were analyzed using the Pfaffl method. The primer sequences used were Noxa : forward: GTCGGAACGCGCCAGTGAACCC, reverse: TCCTTCCTGGGAGGTCCCTTCTTGC; Slug : forward: GATGTGCCCTCAGGTTTGAT, reverse: ACACATTGCCTTGTGTCTGC; and 18s: forward: TGG CTC ATT AAA TCA GTT ATG GT, reverse: GTC GGC ATG TAT TAG CTC TAG. Immunoblotting Protein immunoblotting was performed as described previously. Cell lysates were mixed with sample loading buffer 125 mM Tris base pH 6. After heating, the protein was resolved on a sodium dodecyl sulfate-15% polyacrylamide gel and transferred to a Hybond-ECL nitrocellulose membrane Amersham, Piscataway, NJ, USA. The membrane was washed with TBS-T three times and incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody. Noxa 20 инструкция membrane was washed three times with TBS-T and analyzed by enhanced chemiluminescence Amersham. After staining, 20 fields of alveoli ×400 were randomly chosen, and TUNEL-positive nuclei were counted using ImageJ software. Statistics Differences between groups were explored using analysis of variance ANOVA. All analyses were performed using GraphPad Prism version 4. Data are shown as means ± se. Exposure to PM 2. Noxa sequesters proapoptotic or inhibits antiapoptotic Bcl-2 proteins to activate Bax noxa 20 инструкция Bak and induce cell death, while Puma directly activates Bax or Bak. Noxa 20 инструкция examine the role of Noxa and Puma in Noxa 20 инструкция 2. After 6 h, we harvested RNA from these cells and measured the levels of Noxa and Puma using real-time RT-PCR. Treatment with PM 2. Compared with PBS-treated animals, PM 2. By contrast, PM 2. Intratracheal instillation of PM 2. A A549 cells were treated with PM 2. The activation of p53 in response to DNA damage can result in cell cycle arrest and DNA repair or the activation of the intrinsic apoptotic pathway. A transcriptional target of p53, Slug, has been shown to inhibit the transcription of Puma in response to the activation of p53. In noxa 20 инструкция, Strasser and colleagues reported that the activation of Slug by p53 accounted for the requirement for Noxa rather than Puma in the cell death induced noxa 20 инструкция ionizing radiation. We sought to determine whether activation of Slug might account for our failure to observe increased Puma transcription in isolated cells or whole lungs following the instillation of PM 2. We treated wild-type mice with PBS or PM 2. Compared with PBS-treated noxa 20 инструкция, PM 2. Noxa is required for particulate matter-induced cell death in noxa 20 инструкция epithelial cells To determine whether Noxa is required for PM 2. Two days after isolation, when the cells had formed a confluent monolayer, they were exposed to PM 2. In alveolar epithelial cells from wild-type mice, treatment with PM 2. Noxa is required for PM 2. On d 3, cells were treated with PM. Exposure to PM 2. We sought to determine whether the increase in Noxa that we observed in response to PM 2. We isolated primary alveolar epithelial cells from rats and exposed them to PM 2. At 4 and 6 noxa 20 инструкция after treatment with PM 2. Treatment with PM 2. Exposure to anoxia 0% oxygen was used as a positive control. Exposure to PM 2. To determine whether Noxa was required for PM 2. We then examined fixed lung sections from these animals for TUNEL-positive nuclei. Treatment with PM 2. Intratracheal instillation of PM 2. Noxa 20 инструкция is required for the PM 2. Significant increases in permeability were observed in wild-type animals 24 h after the instillation of 100 or 200 μg of PM 2. In contrast to wild-type animals, treatment with PM 2. Exposure to PM 2. A Wild-type mice were treated with PBS or PM 2. To determine whether the loss of Noxa or Puma prevented lung inflammation in response to PM 2. In all three groups, the increase in cells was attributable to an increase in both macrophages and neutrophils. These results suggest that the loss of Noxa specifically attenuates the lung inflammation induced by particulate matter. Inflammatory response to PM 2. B, C In a separate. The administration of PM 2. Noxa is required for the increase in IL-6 induced by PM 2. The levels of IL-12p70, IL-10, and MCP-1 were not significantly changed by treatment with PM 2. DISCUSSION Exposure to particulate matter is associated with increased short and long-term morbidity and mortality from cardiovascular diseases ,. In addition, PM 2. We and others have reported that exposure of cells to high doses of PM 2. In this study, we found that transcription of the proapoptotic Bcl-2 protein Noxa was induced in alveolar epithelial cells and in the lungs of mice following exposure to PM 2. The instillation of PM 2. All of these findings were absent or attenuated in mice lacking Noxa. By contrast, noxa 20 инструкция number of apoptotic cells noxa 20 инструкция the severity of PM 2. These results suggest that Noxa-dependent apoptosis contributes to the inflammatory response to PM 2. Stimuli that result in DNA damage activate the tumor suppressor p53 reviewed in ref. The activation of p53 results in cell cycle arrest and the induction of DNA repair enzymes or activation of the intrinsic apoptotic pathway. Apoptosis mediated by p53 is largely the result of noxa 20 инструкция transcriptional activation of proapoptotic Bcl-2 proteins, with an additional contribution from nontranscriptional mechanisms. The major transcriptional targets of p53 are the proapoptotic Bcl-2 proteins Noxa and Puma. Puma can directly activate Bcl-2 proteins capable of permeabilizing the outer mitochondrial membrane Noxa 20 инструкция, Bak, or Bik. Noxa specifically antagonizes the activity of an antiapoptotic Bcl-2 protein, Mcl-1, to release activator proteins that activate Bax or Noxa 20 инструкция. Our findings suggest that PM 2. Our findings parallel those reported by Strasser and colleagueswho examined the role of Noxa, Puma, and Bim in the activation of the intrinsic apoptotic pathway by ionizing radiation. Similar to our findings, they observed that mice lacking Noxa showed almost complete inhibition noxa 20 инструкция apoptosis in skin exposed to noxa 20 инструкция radiation. Exposure of cells from wild-type and knockout animals to IR demonstrated a consistent increase in the abundance of Noxa following radiation, while an increase in Puma was observed only in some cells. Noxa 20 инструкция variability in the induction of Puma was inversely correlated with the activation of Slug. Slug is a zinc-finger protein that is both a transcriptional target of p53 and acts as a direct repressor of Puma transcription. As such, Slug is capable of modulating the p53 response to DNA damage by inhibiting Puma-mediated apoptosis, perhaps allowing for DNA repair. We observed that exposure to PM 2. Death of both alveolar epithelial and endothelial cells has long been recognized in the lungs of animals with lung injury reviewed in ref. In an LPS model of lung injury, the same group noxa 20 инструкция investigators reported that inhibition of Fas-mediated apoptosis attenuated noxa 20 инструкция injury. We reported that activation of the intrinsic pathway through the proapoptotic protein Bid was required for the development of apoptosis and the lung injury observed after the intraperitoneal administration of LPS. In this study, we report that apoptosis induced by exposure noxa 20 инструкция PM 2. Even more interesting, the prevention of apoptosis ameliorated the PM 2. It is unlikely that the loss of Noxa in inflammatory cells explains our findings as the loss of other BH3 domain only proteins has been shown to enhance the inflammatory response in other forms of lung injury. In this study, we observed small but significant increases in the permeability of the noxa 20 инструкция barrier to a small dextran molecule and an increase in the BAL fluid protein level at moderate doses of PM 2. While the noxa 20 инструкция employed in this study are higher than those that would typically be experienced in the developed world, anatomic factors and regional heterogeneity of ventilation might result in the exposure of some regions of the epithelium to relatively high doses of PM. This inequality of distribution is likely to be more pronounced in individuals with obstructive lung disease that exhibit regional heterogeneity of ventilation. Our results suggest that apoptosis occurring in lung regions exposed to relatively high concentrations of PM 2. Similar to other investigators, we observed an increase in the total number of noxa 20 инструкция cells in the BAL fluid obtained from wild-type mice 24 h after exposure to PM 2. This increase in cells was attributable to an increase in the number of both macrophages and neutrophils. The increase in inflammatory cells in the Noxa 20 инструкция fluid was reflected by an increase in the BAL levels noxa 20 инструкция the proinflammatory cytokines IL-6 and TNF-α; however, there were minimal changes in the levels of other proinflammatory cytokines, IFN-γ, IL-12p70, and MCP-1. The increase in Noxa 20 инструкция, but not TNF-α was attenuated in mice lacking Noxa. By noxa 20 инструкция, mice lacking Puma had increased numbers of inflammatory cells, particularly neutrophils and equal or higher levels of proinflammatory cytokines when compared with wild-type animals. We and others have reported that the administration of PM 2. Our noxa 20 инструкция suggest that the noxa 20 инструкция Noxa-dependent apoptosis might modulate the release of IL-6 by alveolar macrophages; however, the precise mechanisms by which noxa 20 инструкция occurs are not clear. Because we used mice globally deficient in Noxa, we are unable to conclude whether the alveolar epithelium is the only cell that undergoes apoptosis in response to PM 2. It noxa 20 инструкция possible that other lung cells e. Cell type-specific knockdown of Noxa noxa 20 инструкция different cell types could be used to address these questions. We previously reported that primary alveolar epithelial cells isolated from human lungs immediately postmortem and from rats underwent p53-dependent cell death in response to PM 10. We also reported that treatment with PM 10 resulted in an increase in the number of TUNEL-positive nuclei in mouse lungs harvested 24 h after exposure and that some of noxa 20 инструкция cells stain positively for the alveolar epithelial Type I cell marker T1α. The majority of our in vitro experiments were performed using primary alveolar Type II cells from mice and rats. When noxa 20 инструкция in culture, these cells show a progressive loss of Noxa 20 инструкция II cell markers and gain in Type I cell markers. Because of these limitations, it is not possible for us to conclude whether Type I or Type II alveolar epithelial cells are more susceptible to PM 2. In conclusion, the intratracheal administration of PM 2. Mice lacking Noxa failed to demonstrate apoptosis in the lung after the instillation of PM 2. Our results provide a novel link between the apoptosis of alveolar epithelial cells and the inflammatory response elicited by acute exposure to PM 2. Noxa 20 инструкция authors thank Dr. Jacob Sznajder and Dr. David Green for their advice during the performance of these experiments and preparation of the manuscript. This work was supported noxa 20 инструкция NIH grants HL071643, GM060472, HL067835, ES015024, and ES013995, and by The American Lung Association. Dominici F, McDermott A, Zeger S L, Samet J National maps of the effects of particulate matter on mortality: exploring geographical variation. Confounding and effect modification in the short-term effects of ambient particles on total mortality: results from 29 European cities within the APHEA2 project. Fine particulate air pollution and mortality in 20 N Engl J Med. An association between air pollution and mortality in six N Engl J Med. Cardiovascular mortality and long-term exposure to particulate air pollution: epidemiological evidence of general pathophysiological pathways noxa 20 инструкция disease. Long-term ambient concentrations of total suspended particulates and oxidants as related to incidence of chronic disease in California Seventh-Day Adventists. Respiratory effects of exposure to diesel traffic in persons with asthma. N Engl J Med. N Engl J Med. Long-term exposure to air pollution and incidence noxa 20 инструкция cardiovascular events in women. N Engl J Med. Air pollution noxa 20 инструкция cardiovascular disease: a statement for healthcare professionals noxa 20 инструкция the expert panel on population and prevention science of the American Heart Association. Air pollution and health. Particulate air pollutants and asthma. A paradigm for the role of oxidative stress in PM-induced adverse health effects. Airborne particulate matter inhibits alveolar fluid reabsorption in mice via oxidant generation. Am J Respir Cell Mol Noxa 20 инструкция. Am J Respir Crit Care Med. Bcl-2, bcl-x l sequester bh3 domain-only molecules preventing bax- and bak-mediated mitochondrial apoptosis. Ultraviolet radiation triggers apoptosis of fibroblasts and skin keratinocytes mainly via the BH3-only protein Noxa. Speciation of elements in NIST particulate matter SRMs 1648 and 1650. Upregulation of alveolar epithelial active Na + transport is dependent on beta2-adrenergic receptor signaling. Proapoptotic Bid is required for pulmonary fibrosis. Proc Natl Acad Sci U S Noxa 20 инструкция of Mcl-1 protein and inhibition of electron transport chain together induce anoxic cell death. Early detection of apoptosis using a fluorescent conjugate of annexin A new mathematical model for relative quantification in real-time RT-PCR. Ultraviolet radiation stimulates expression of Snail family transcription factors in keratinocytes. Hyperoxia-induced apoptosis does not require mitochondrial reactive oxygen species and is regulated by Bcl-2 proteins. Hierarchical regulation of mitochondrion-dependent apoptosis by BCL-2 subfamilies. Slug antagonizes noxa 20 инструкция apoptosis of hematopoietic progenitors by repressing Puma. Pulmonary inflammation and thrombogenicity caused by diesel particles in hamsters: role of histamine. Am Noxa 20 инструкция Respir Crit Care Med. Ambient particulate matter accelerates coagulation via an IL-6 dependent pathway. Lung cancer, cardiopulmonary mortality, and long-term exposure to fine particulate air pollution. Particulate air pollution and the rate of hospitalization for congestive heart failure among medicare beneficiaries in Pittsburgh, Pennsylvania. Air pollution and hospital admissions for ischemic and hemorrhagic stroke noxa 20 инструкция Medicare beneficiaries. The role of a mitochondrial pathway in the induction of apoptosis by chemicals extracted noxa 20 инструкция diesel exhaust particles. Particulate matter induces alveolar epithelial cell DNA damage and apoptosis: role of free radicals and the mitochondria. Am J Respir Cell Mol Biol. Puma is an essential mediator of p53-dependent and -independent apoptotic pathways. Science review: apoptosis in acute lung injury. Soluble Fas ligand induces epithelial cell apoptosis in humans with acute lung injury ARDS Crit Care. Matute-Bello G, Liles W C, Frevert C W, Nakamura M, Ballman K, Vathanaprida C, Kiener P A, Martin T Recombinant human Fas ligand induces alveolar epithelial cell apoptosis and lung injury noxa 20 инструкция rabbits. Noxa 20 инструкция J Physiol Lung Cell Mol Physiol. Clin Diagn Lab Immunol. The intrinsic apoptotic pathway is required for lipopolysaccharide-induced lung endothelial cell death. Airway branching patterns influence asbestos fiber location and the extent of tissue injury in the pulmonary parenchyma. Ambient atmospheric particles in the airways of human lungs. Regulation of COX-2 expression and IL-6 release by particulate matter in airway epithelial cells. Am J Respir Cell Mol Biol. Differential expression of Na-K-ATPase isoforms in rat alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol.


Другие статьи на тему:



 
Copyright © 2006-2016
oglion.ru